Meta Gene br Results br Demographics of the

Meta Gene 21 (2019) 100583
3. Results
3.1. Demographics of the study population
The demographic profile including age, gender, habitual risk factors and tumor clinical characteristics which may contribute to the pro-gression of oral lesions and OSCC, are shown in Table 2. In brief, the study recruited 302 oral disease cases, including 203 (67%) males and 99 (33%) females. Calculated mean age of cases was 46.67. The mean age of 300 healthy controls [73% males and 27% females] was 38.02.
Table 1
Primers and restriction enzymes used for genotyping of various polymorphisms in oral pre cancer & cancer patients and controls.
Gene Primer sequence Annealing temp. (°C) Restriction enzyme
XPC (PolyAT) D/I F-“GTAGTCGGGAGAAAGCCTGTT” 58 NA
XPC (Exon9) C/T R-“TGGTTTGGGAAGAGGAAAAGA” 63.1 AciI
F-“GACAAAGGCTGGGTCCAAGA
XPC (Exon15) A/C R-“CCACTTTTCCTCCTGCTCAC” 67 PuvII
F-“GATGCAGGAGGTGGACTCTCT”
R-“GTAGTGGGGCAGCAGCAACT”
Table 2
Demographic in patient and controls.
Demographic character Cases Control P- value
Median age 47
Habitual risk
Yes
Yes
Yes
Leukoplakia
Clinical features of oral cancer
subjects
I
Cell differentiated grade 31 (45%)
Grade 1
Table 3
Distribution of different genotypes and 2-Guanidinoethylmercaptosuccinic Acid of XPC PAT D > I, C > T and
A > C polymorphisms among subjects of oral diseases (pre cancer and cancer) and healthy controls.
XPC PAT D/I Cases (Oral Controls p- value Odds ratio 95% CI
genotypes diseases)
Significant association.
Smoking and tobacco chewing have been observed as two significant risk enhancers for the development of oral diseases (p value < .001). Types of oral diseases included in this study are also documented in Table 2, which includes 23.33% leukoplakia, 30% OSMF, 22.33% Li-chen planus and 23.33% Oral Squamous Cell Carcinoma cases. Clinical parameters of oral cancer patients at the time of diagnosis including, tumor stage, size (Tumor T status), grade, nodal involvement, metas-tasis are also documented in Table 2.
3.2. Genotypes of XPC polymorphisms and risk of oral diseases
Distribution of different genotypes and alleles for XPC A > C (Lys939Gln, rs2228001), C > T (Ala499Val, rs2228000) and intron 9 PAT (D > I) polymorphisms among the cases of oral diseases (pre oral and oral cancer) and control are shown in Table 3. In control population all the genotypes were at Hardy-Weinberg equilibrium. With reference to D/D genotype, frequency of D/I genotypes for intron 9 PAT (D > I) polymorphism was significantly lesser in cases than in control popula-tion indicating a protective association of D/I genotype with the de-velopment of oral diseases (OR = 0.590, p value = .004). A similar protective association was also documented with CT and TT genotypes of XPC C > T polymorphism. As compared to CC genotype, the fre-quency of CT and TT genotype was significantly lower in cases than in control (OR = 0.587 and 0.582 respectively). In contrast, with re-ference to AA genotype odds for developing oral diseases was margin-ally higher with the CC genotype of XPC A > C polymorphism (OR = 1.619).
3.3. Genotypes of XPC polymorphisms and risk of pre malignant lesions and oral cancer
As the study showed association of studied XPC polymorphism with the oral disease, we assessed whether they were associated with oral premalignant lesions or oral cancer and thus further stratified our cases in two groups: (i) patients with pre oral cancer lesion and (ii) patients with oral cancer. Distribution of different genotypes and alleles for XPC polymorphisms among the patients of pre oral cancer lesions and his-tologically confirmed oral cancer patients are documented in Table 4. The protective association of variant allele genotype (D/I and I/I) for XPC intron 9 polymorphism was documented both with pre malignant
Table 4
Frequency distribution of different genotypes and alleles of XPC PAT D > I, XPC C > T, XPC A > C polymorphisms among oral pre cancer (Oral submucous fibrosis + Lichenplanus, + Leukoplakia), cancer and controls.
Genotypes Pre-oral cancer P-value Odd ratio (95% CI) Oral cancer P- value Odd ratio (95% CI) Controls
Significant association.
3.4. Haplotypes of XPC polymorphisms and risk of oral diseases
Haplotyping of XPC A > C (rs2228001) C > T (rs2228000) and intron 9 PAT (D > I) (rs77907221) polymorphisms generated 8 dif-ferent haplotypes as detailed in Table 6. Compared to the A/C/D hap-lotype the frequency of A/T/D and A/T/I haplotype were significantly higher among the control population than in patients with oral diseases (Table 6) indicating a protective association of these haplotypes with the susceptibility to develop any kind of oral disease including pre malignant lesions and oral cancer. The frequencies of other haplotypes were almost similar between cases and controls. Further, the above polymorphisms of XPC were not in significant LD (D = 0.0089 for D/I and C > T; 0.0477, for D/I and A > C and 0.0411 for C > T and A > C polymorphism).